Considerations for the Hybrid Use of Trade Secret and Patent - - PowerPoint PPT Presentation

▶
considerations for the hybrid use of trade secret and
SMART_READER_LITE
LIVE PREVIEW

Considerations for the Hybrid Use of Trade Secret and Patent - - PowerPoint PPT Presentation

Considerations for the Hybrid Use of Trade Secret and Patent Protection of Green Technology 26 th Annual Intellectual Property Law Conference American Bar Association Section of Intellectual Property Law Susan Perng Pan span@sughrue.com April


slide-1
SLIDE 1

Considerations for the Hybrid Use of Trade Secret and Patent Protection of Green Technology

26th Annual Intellectual Property Law Conference American Bar Association Section of Intellectual Property Law

Susan Perng Pan

span@sughrue.com April 6-9, 2011

slide-2
SLIDE 2

Considerations for a “Hybrid” IP Approach to Green Technology

  • Costs
  • Requirements for trade secret
  • Information is of economic or competitive value
  • Formulas, drawings, patterns, compilations, programs,

devices, methods, techniques, processes

  • Information is not well-known and derives economic value

from not being well-known

  • Reasonable efforts are taken to keep information

confidential

  • Relatively less costly
  • Patents
  • Requires preparation of patent disclosure
  • Requires responses to Office Actions
  • Government fees (filing, issue, maintenance)
  • Patent applications may take a long time to issue
  • USPTO does have programs to shorten pendency
  • Uncertainty about rights of exclusivity during pendency
slide-3
SLIDE 3

Considerations for a “Hybrid” IP Approach to Green Technology

Effectiveness of type of protection over life of technology

  • How quickly may the technology become out-dated?
  • How easily may the process, device, formula or

method be reversed engineered, or independently discovered?

  • Patents exclude the practice of reverse-engineered

products or independently discovered products for a period of time

  • Trade secrets do not provide for exclusion of reverse

engineered or independently discovered products

  • How much movement is there among professionals in

the area of the technology?

  • All patent applications, except those subject to a

potential §102(b) bar due to inventor’s prior publication, or prior use or sale, begin as a trade secret.

slide-4
SLIDE 4

Application of a Dual Approach

Coskata, www.coskata.com/process/ (last visited, February 18, 2011).

slide-5
SLIDE 5

Application of a Dual Approach (Physical Component)

Coskata’s U.S. Publication No. 2009/0029434

slide-6
SLIDE 6

Application of a Dual Approach (Bio-Chem Component)

Genes encoding key catalyzing mechanisms for ethanol production from syngas fermentation

  • 1. An isolated polynucleotide comprising a

nucleotide sequence encoding an operon that codes for carbon monoxide dehydrogenase, a membrane-associated electron transfer protein, a ferredoxin oxidoreductase, and a promoter, said sequence being at least 77% identical to atgtcaaataacaaaatttg… <i.e.SEQ ID

  • NO. 1.>

Coskata’s U.S. Publication No. 2011/0008860

slide-7
SLIDE 7

Additional “Green Tech” Examples Where Dual Approach Can Be Effective

Wind turbines

  • Physical components:

Blade and head structures; devices and methods of assembly

  • Chemical component:

Lubricants to facilitate rotation

U.S. Publication No. 2010/0028152

slide-8
SLIDE 8

Additional “Green Tech” Examples Where Dual Approach Can Be Effective

Solar cell assemblies

  • Physical

components: substrate arrangements, n- and p- electrode interconnections

  • Chemical or process

component: solar photovoltaic semiconductor materials and processes for semiconductor purity

U.S. Publication No. 2010/0018565

slide-9
SLIDE 9

Additional “Green Tech” Examples Where Dual Approach Can Be Effective

Battery

  • Physical

components: physical cell configurations and arrangements

  • Chemical or process

component: electrolyte materials and formulations

U.S. Publication No. 2010/0003582

slide-10
SLIDE 10

Patent considerations in view of trade secret disclosures

  • In normal course, patent application will publish

within 18 months of filing, or earliest priority date

  • Can avoid publication to maintain trade secret status
  • Expressly abandon the application to avoid

abandonment (37 C.F.R. 1.138(c))

  • File the request at least four weeks prior to expected

18 month publication date

OR

  • File patent with non-publication request
  • Certify that the application has not and will not be filed in a

foreign country with an 18 month publication requirement

  • Conspicuous and signed request for non-publication
  • Can retract the request for non-publication
slide-11
SLIDE 11

Patent considerations in view of trade secret disclosures

  • During time of patent application pendency
  • Applicant should track time to publication
  • Preservation of trade secret
  • Avoid having its own publication hinder patentability of

improvement on original invention

  • Applicant to evaluate relative strength of trade secret

protection vs. patent protection via continued investigations of the invention

  • If Applicant’s continued investigations tend to move in a

different direction or yields more specific information than

  • riginal patent application
  • Applicant can continue patent protection route for current

application

  • Applicant may also file a continuation-in-part application. Any new

disclosures of c-i-p will be held in confidentiality until publication (may occur earlier than 18 months from filing date with the priority claim to original patent)

  • Applicant can abandon the patent protection route and maintain

trade secret

slide-12
SLIDE 12

Evaluation of relative strength of trade secret protection vs. patent protection

  • Can be difficult to evaluate if the application is filed in a

USPTO Group Art Unit with a significant examination

  • backlog. Application may publish prior to receipt of the

first Office Action

  • May request for expedited examination by submitting

Examination Support Document with request for accelerated examination

  • USPTO to issue a final determination within one year
  • Earlier issuance of a substantive rejection or an

allowance

  • Abandonment should be affirmatively made if trade

secret to be maintained once examination under accelerated program begins

slide-13
SLIDE 13

USPTO Green Tech Incentives

  • Green Technology pilot program extended to December

31, 2011, or when 3000 applications are accepted into program (currently, 1595 petitions have been granted).

  • Not the same program as “accelerated examination”
  • Invention contributes to

Environmental quality Discovery or development of renewable energy resources More efficient utilization and conservation of energy resources Reduction of Greenhouse gas emissions

  • Applicant must request early publication of application
  • May be sacrificing some trade secret protection
  • Applicant must agree to respond to telephone restriction,

if necessary

slide-14
SLIDE 14

USPTO Green Tech Incentives Request to participate in Green Technology Pilot must be received prior to first Office Action on merits

  • Written Restriction/Election qualifies as a first Office Action
  • n merits

National stage applications qualify for pilot Limits on claims

  • Claims cannot exceed 3 independent claims and 20

claims total

  • No multiple dependent claims permitted
slide-15
SLIDE 15

USPTO Green Tech Incentives

Pilot program projected to shorten pendency cycle of application by 12 months First Office Action on the merits usually provided within 49 days of acceptance of Petition to Make Special under Pilot program Many applications issue within 1 year 250 applications of 1595 granted “Green” petitions have already been passed to issue

slide-16
SLIDE 16

USPTO Green Tech Incentives

Tech Center Name of Technology Center Number of Petitions 1600 Biotechnology and Organic Chemistry 145 1700 Chemical and Materials Engineering 849 2100 Computer Architecture, Software, and Information Security 144 2400 Computer Networks, Multiplex Communication, Video Distribution, and Security 11 2600 Communication 23 2800 Semiconductors, Electrical and Optical Systems and Components 789 3600 Transportation, Construction, Electronic Commerce, Agriculture, National Security, and License & Review 307 3700 Mechanical Engineering, Manufacturing Products 761 4100 Patent Training Academy 11 Not Assigned 61 www.uspto.gov/patent/init_events/green_tech.jsp#heading-5 (last visited April 7, 2011)

slide-17
SLIDE 17

§112 Requirements to consider in a dual approach

  • Enablement and best mode
  • The specification shall contain a written description of

the invention, and the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. (35 U.S.C. § 112, first paragraph)

  • Recent Cases
  • Green Edge Enterprises LLC v. Rubber Mulch 620 F3d 1287

(Fed. Cir. 2010).

  • Bayer AG v. Schein Pharmaceuticals, Inc., 301 F3d 1306,

1314 (Fed. Cir. 2002).

  • Ajinomoto Co. v. Int’l Trade Comm’n, 597 F3d 1267 (Fed.
  • Cir. 2010).
slide-18
SLIDE 18

Satisfying Section 112 Requirements

  • Inquiry 1: At the time the application was filed, did the

inventor possess a best mode of practicing the claimed invention?

  • Subjective intent of inventor
  • Did the inventor have personal preferences as of the filing

date of the application?

  • Inquiry 2: If the inventor had a preference, did the

inventor conceal this preferred mode from the public?

  • Objective determination, viewed from the standpoint of one

skilled in the art

  • In the case of proprietary information, did the inventor

adequately disclose the source and identification of materials to practice or enable the best mode?

  • For proprietary information, must disclose manufacturer

and product name used to satisfy best mode

slide-19
SLIDE 19

Satisfying Best Mode

Carefully assess what your claims recite Best mode does not compel the disclosure of unclaimed and unclaimed starting materials beyond enablement of the invention Best mode is not satisfied if written description fails to disclose aspects of making or using the invention and such undisclosed matter materially affects properties of the claimed invention*

*Bayer v. Schein

slide-20
SLIDE 20

Satisfying Best Mode

1. A compound of the formula

  • r a pharmaceutically acceptable acid addition salt or an alkali or alkaline

earth metal salt thereof, in which A represents CR3 wherein R3 denotes a halogen atom, and Z represents C-H, and R1 and R2 together with the nitrogen atom which they substitute form a piperzino group.

  • - No violation of Section 112 where preferred method of obtaining an

(unclaimed) intermediate material 6-FQA via “Klauke compound” was not disclosed, but other methods of obtaining 6-FQA were disclosed

U.S. Patent No. 4,670,444, Bayer v. Schein

slide-21
SLIDE 21

Satisfying Best Mode

  • 15. A method of producing L-lysine, comprising: cultivating a

bacterium belonging [to] the genus Escherichia which is transformed with a DNA coding for a dihydrodipicolinate synthase originating from a bacterium belonging to the genus Escherichia and having mutation to desensitize feedback inhibition of L-lysine, wherein the mutation is selected from the group consisting of [a mutation to replace the alanine residue at the 81st position and/or a mutation to replace the histidine residue at the 118th position] in a suitable culture medium, producing and accumulating L-lysine in the culture thereof, and collecting L-lysine from the culture.

  • Patentee argued that claim was limited to particular mutation

(bolded), and the specification enabled how to obtain that mutation, thereby satisfying all requirements of Section 112

  • However, ITC and Federal Circuit determined claim to be

broader, including cultivation of bacterium. Failure to disclose preferred bacterium as starting material violated best mode.

U.S. Patent No. 6,040,160, at issue in Ajinomoto v. ITC

slide-22
SLIDE 22

Satisfying Best Mode

  • 1. An isolated polynucleotide comprising a nucleotide sequence

encoding an operon that codes for carbon monoxide dehydrogenase, a membrane-associated electron transfer protein, a ferredoxin oxidoreductase, and a promoter, said sequence being at least 77% identical to tgtcaaataacaaaatttg…

  • 6. A method of producing ethanol comprising: isolating and

purifying anaerobic ethanologenic micro-organisms carrying the polynucleotide of claim 1; fermenting syngas with said micro-organisms in a fermentation reactor.

  • Would there be significant differences in the best mode

inquiry for the above claims?

slide-23
SLIDE 23

Conclusion

  • Trade secret protection and patent protection are not

mutually exclusive

  • Can use a dual approach to protecting inventions after

assessing the ease of reverse-engineering or independent discovery of the innovation to be protected

  • If patents and trade secrets are pursued in parallel,
  • Be wary of application deadlines which could extinguish trade

secret protection

  • Make sure scope of best mode disclosure is commensurate

with claims

  • Always identify proprietary source materials by manufacturer

and product

  • Enlist USPTO accelerated examination to better evaluate

whether patent or trade secret protection is more effective form of protection

  • Enlist USPTO “green tech” incentives for earlier patent

examination and issuance

slide-24
SLIDE 24

Thank you

For Questions or Comments, contact: Susan P. Pan Sughrue Mion, PLLC span@sughrue.com 202 663 7373