molecular mechanisms in Heavy Chain Deposition Disease Presented by - PowerPoint PPT Presentation
Contribution in the understanding of the molecular mechanisms in Heavy Chain Deposition Disease Presented by Sbastien BENDER Disclosure of Conflict of Interest x I do not have a relationship with a for-profit and/or a not-for-profit
Contribution in the understanding of the molecular mechanisms in Heavy Chain Deposition Disease Presented by Sébastien BENDER
Disclosure of Conflict of Interest x I do not have a relationship with a for-profit and/or a not-for-profit organization to disclose ❑ I have a relationship with a for-profit and/or a not-for-profit organization to disclose Name of for-profit or not-for-profit Description of relationship(s) Nature of relationship(s) organization(s) Any direct financial payments including receipt of honoraria Membership on advisory boards or speakers’ bureaus Funded grants or clinical trials Patents on a drug, product or device All other investments or relationships that could be seen by a reasonable, well-informed participant as having the potential to influence the content of the educational activity
Molecular mechanisms of HCDD Heavy Chain Deposition Disease =HCDD ▪ Deposition of a truncated heavy chain (HC), mainly in the kidney. ▪ Non-organized/amorphous deposits along tubular and glomerular basement membranes. ▪ Proteinuria. ▪ Nodular glomerulosclerosis. Sclerotic glomerulus Healthy glomerulus 3
Molecular mechanisms of HCDD CH1 deletion is always present in HCDD VDJ CH1 H CH2 CH3 Normal 1 γ1 case 1 = Binding Ig Protein 4
Molecular mechanisms of HCDD 5
Molecular mechanisms of HCDD Can CH1 deletion occur due to a problem with the light chain (LC)? 6
Molecular mechanisms of HCDD 7
Molecular mechanisms of HCDD Identification of 2 monoclonal components Lambda light chain Gamma heavy chain Serum Serum BM The 2 components are produced by the same clone Merge @human lambda @human gamma 8 BM
Molecular mechanisms of HCDD The lambda light chain has its V domain truncated Leader FR1 λ mRNA atggcctgggctctgctgctcctcaccctcctcactcagggcacaggatcctgggctcagtctgccctgactcagcctccctccgtgtccgggtctcctggacagtcagtcaccatctcc Prot M A W A L L L L T L L T Q G T G S W A Q S A L T Q P P S V S G S P G Q S V T I S VC junction CDR1 C λ 3 λ mRNA tgcactggaatcagcagtgacgttggtcagcccaaggctgccccctcggtcactctgttcccaccctcctctgaggagcttcaagccaacaaggccacactggtgtgtctcataagtgac Prot C T G I S S D V G Q P K A A P S V T L F P P S S E E L Q A N K A T L V C L I S D C λ 3 λ mRNA ttctacccgggagccgtgacagtggcctggaaggcagatagcagccccgtcaaggcgggagtggagaccaccacaccctccaaacaaagcaacaacaagtacgcggccagcagctacctg Prot F Y P G A V T V A W K A D S S P V K A G V E T T T P S K Q S N N K Y A A S S Y L C λ 3 λ mRNA agcctgacgcctgagcagtggaagtcccacaaaagctacagctgccaggtcacgcatgaagggagcaccgtggagaagacagtggcccctacagaatgttcatag Prot S L T P E Q W K S H K S Y S C Q V T H E G S T V E K T V A P T E C S - L V J C λ 3 gDNA +22nt -19nt cDNA L V C λ 3 9 Protein
Molecular mechanisms of HCDD CH1 deletion of the heavy chain is genomic VDJ CH1 H CH2 CH3 Normal 1 γ1 case 1 Sµ-S γ 1 H CH2 CH3 L CH1 VDJ gDNA C B cDNA L VDJ H CH2 CH3 Protein 10
Molecular mechanisms of HCDD Is the truncated LC can associate with a HC ? ] i n c u t u r e s u p e r n a t a n t s [ I g G 6 0 0 0 ? ? [IgG ] in ng/mL 4 0 0 0 2 0 0 0 Δλ λ control ND l + ɣFL ɣFL 0 L L t r o F F + n o c 11
Molecular mechanisms of HCDD Is the CH1 deletion beneficial to the plasma cell ? + OR Δλ ɣFL Δ ɣ HC secretion Stress marker Xbp1-s expression in sp2/0 clones * ** Relative mRNA expression 2.5 80 20 [ ] intracellulaire/sécrété [ ] intracellular/secreted 2.0 60 15 1.5 ns 1.0 40 10 0.5 20 5 0.0 + + 0 0 L F ) ) +) FL+) (+ FL(+ ( Xbp1-s ( 12
Molecular mechanisms of HCDD L VDJ CH1 H CH3 CH2 1 Immunoglobulin + VJ λ C λ PLASMA CELL L H CH2 CH3 Oncogenics events CH1 VDJ L 2 PROLIFERATION + L V λ C λ CH2 CH3 VDJ H L Truncated light 3 chain + C λ L V λ Truncated heavy chain 13
Molecular mechanisms of HCDD A new model to mimic the loss of the light chain L VJk Ck Light chain of Fanconi syndrome mouse model LoxP LoxP Recombinase CRE induction Ck Light chain of Fanconi syndrome mouse model (deleted) CH1 H L VDJ CH3 CH2 Mouse heavy chain ? 14
Conclusion ▪ We showed that deletion of the LC could be the first event leading to the generation of a truncated heavy chain in HCDD ▪ Results must be confirmed in other HCDD patients ▪ Regarding the mouse model first tests are ongoing 15
Thank you for Pr Arnaud Jaccard Pr Christophe Sirac your attention Pr Guy Touchard Pr Frank Bridoux Maria Victoria Ayala Amélie BONAUD Dr Vincent Javaugue 16
Recommend
More recommend
Explore More Topics
Stay informed with curated content and fresh updates.