rna structure modeling gdr masim paris 16 17 th november

RNA Structure modeling GDR MASIM Paris, 16-17 th November 2017 - PowerPoint PPT Presentation

RNA Structure modeling GDR MASIM Paris, 16-17 th November 2017 Bruno Sargueil, CNRS UMR 8015 Facult de pharmacie PARIS Bruno.sargueil@parisdescartes.fr RNA structure Primary structure 5


  1. RNA Structure modeling GDR MASIM Paris, 16-17 th November 2017 Bruno Sargueil, CNRS UMR 8015 Faculté de pharmacie – PARIS Bruno.sargueil@parisdescartes.fr

  2. RNA structure • Primary structure 5’ aaaaagcaaaaatgtgatcttgcttgtaaatacaattttgagaggttaataaattacaagtagtgcta tttttgtatttag gttagctatttagctttacgttccagg atgcctagtg gcagccccac aatatccagg aagccctctctgcggttttt 3’ • Secondary structure • Tertiary structure

  3. Nucleotide interactions

  4. Some examples of tertiary motifs

  5. RNA structure modeling • Secondary structure modeling is a limiting step • Structure modeling software (Mfold, RNAfold …) are based on : • Thermodynamic – experimental data have defined a free energy for a bp in a given context (nearest neighbour theory) • Probability (Boltzmann statistics) • Such modeling is often inexact if the RNA is over > 50(ish) nucleotide long • Thermodynamic model is incomplete • Does not predict non canonical base pairs – pseudoknots • Does not take into account folding kinetics • A single RNA may adopt several foldings • Yields several models – how to choose?

  6. Generating folding constraints Goal: Experimentally define nucleotides that are in single strand conformation • Single stand RNAse : T1, A, S1 etc … • Small molecules: DMS, CMCT, SHAPE reagents

  7. Probing RNA structure The reactivity map is used as (soft) constrains by the modeling software (Bonus/penalty)

  8. Is this enough ? Modeling using probing structure data X-Ray structure Modeling without constraint Not predicting the tertiary structure impairs the 2D prediction

  9. Multiple probes Each molecular probe brings different information The experimental process has been entirely automated Use a multiprobing approach to improve modeling

  10. Multiprobing approach

  11. Multiprobing approach

  12. Multiprobing approach

  13. Multiprobing approach

  14. Developpement of a new model that takes into account all the probing results Currently validating the approach on a « benchmark » RNA

  15. Detecting the tertiary structure Reactivity low medium high Probing the structure in presence/absence of Mg2+ can reveal tertiary contacts We are currently developping approaches to predict pseudoknots using such data

  16. Combining Probing and NGS

  17. Naive probing of multiple mutants • • •

  18. Loop IIId is crucial for HCV IRES/40S binding H BK Loop IIId B Adapted from Hashem et al. 2014 (CryoEM envelop) Base pairing (kissing complex) between loop IIId (HCV IRES) and ES7 (18S rRNA) favours the 40S recruitment, and is required for an efficient translation

  19. IRES structure and structural rearrangment SHAPE reactivity > 0.7 N Less N 0,5 - 0,7 More Reactive in presence of 40S N 0,2 - 0,5 N 0 - 0,2 WT N Undetermined Loop IIId is protected from modification Domain IV unfolds

  20. IRES footprinting on the18S rRNA ES7 ES7 rRNA loop is protected Pattern modifications are observed in other sites

  21. Fitting the atoms in the envelop Coordinates from Hashem et al. 2013 Model by Benoit Masquida

  22. 3D model of the IRES-40S CryoEM envelop Hashem et al. 2013 Angulo et al. 2016 Model by Benoit Masquida

  23. People involved LIX – Ecole Polytechnique Nathalie Chamond (CR CNRS) Yann Ponty (CR CNRS) Christelle Vasnier (AI CNRS) Afaf Saaidi (PhD Student) Delphine Allouche (PhD Student) Grégoire de Bisschop (M2 student) CIRI Pontificia Universidad Católica ENS Lyon de Chile T.Ohlmann M.Lopez-Lastra S. De Breyne M.Vallejos C. Herbreteau J. Angulo F. Carvajal CNRS UMRR7156 Strasbourg B. Masquida

Recommend


More recommend


Explore More Topics

Stay informed with curated content and fresh updates.