Forensic DNA Phenotyping for Investigative Leads Hwan Young Lee, - PDF document
Forensic DNA Phenotyping for Investigative Leads Hwan Young Lee, Ph.D. Yonsei University College of Medicine This picture is the property of the Genetic Science Learning Center at the University of Utah Conventional Forensic DNA Typing o
Forensic DNA Phenotyping for Investigative Leads Hwan Young Lee, Ph.D. Yonsei University College of Medicine This picture is the property of the Genetic Science Learning Center at the University of Utah Conventional Forensic DNA Typing o Forensic cases -- matching suspect with evidence o Paternity testing -- identifying father Involves generation of DNA profiles usually with the same genetic markers and then MATCHING TO REFERENCE SAMPLE Picture from www.cstl.nist.gov/strbase/NISTpub.htm 1
Advanced Forensic DNA analysis • Human identification Forensic DNA phenotyping (FDP) testing • Ancestry inference • DNA database search • Externally visible characteristics • DNA mass screening • Forensic age estimation Identification markers Intelligence markers Slide from the ISFG 2015 workshop presentation by W. Branicki Forensic Human Identification o Autosomal STRs: multiplex HID kits available o Y-STRs: HID kits available o X-STR: HID kits available o mtDNA: published protocols for CR and complete genomes o SNPs, INDELs: published protocols Slide from the ISFG 2015 workshop presentation by W. Branicki 2
Human Identification Testing o Matching DNA profiles – evidence in favor of hypothesis that two samples come from the same individual o Reference DNA samples needed to perform human ID testing o In many cases suspect is unknown to the investigation Slide from the ISFG 2015 workshop presentation by W. Branicki DNA Database Search DNA profiling 12,14 12,14 28, 30 28, 30 9 9 10 10 16, 17 16, 17 6 6 11, 14 11, 14 11, 13 11, 13 22, 23 22, 23 X, Y X, Y Matching DNA profiles Evidence DNA profiles Reference DNA profiles Slide from the ISFG 2015 workshop presentation by W. Branicki 3
DNA Mass Screening Source: Internet o ENFSI report: 439 finished mass screens – 315 successful o 1998 Germany: rape and murder – 11200 males investigated o 2001 Poland: 14 rapes and murder – 421 males investigated Slide from the ISFG 2015 workshop presentation by W. Branicki Intelligence Markers DNA test Picture from snapshot.parabon-nanolabs.com 4
Ancestry Inference https://www.sott.net/ o Lineage markers (mtDNA andY-STR) o Ancestry Informative Markers (AIMs) o Single Nucleotide Polymorphisms, INDELs o Several to several hundreds markers analyzed o Usually “continental” resolution (EastAsia – Europe – Africa) Madrid Bomber: 34Plex AIM-SNP Assay Bomber from Morocco (2004) 5
Global AIMs panel v2 Slide from the ISFG 2017 presentation by D. Runa Externally Visible Characteristics Source: National Portrait Gallery in Canberra Myopia Pigmentation Stature Hair shape Facial morphology Hair distribution Hair greying Slide from the ICGSK2016 presentation by W. Branicki 6
Eye Color DNA Phenotyping Ind1: CATTTCGCGAT Single Nucleotide Polymorphism (SNP) Ind2: CATTTTGCGAT TT TC CC http://www.erasmusmc.nl/47743/3604975/HIris?lang=en Eye and Hair Color DNA Phenotyping http://www.erasmusmc.nl/47743/3604975/HIris?lang=en 7
Forensic Age Estimation o Information about chronological age of an offender - Predicted age can be used to narrow down the search range o Information about biological age of an offender - Predicted age can improve forensic DNA phenotyping https://internetmedicine.com/aging-and-nanomedicine/ Slide from the ISFG 2015 workshop presentation by W. Branicki Age Prediction with DNA Methylation Met Met GGACAGGGGCGTGGCGCCTGCT 71 CpGs Hannum et al. Mol Cell (2013) 8
Age Prediction in Blood o 5 CpGs in the genes ELOVL2, C1orf132, TRIM59, KLF14 and FHL2 MAD (Mean Absolute Deviation) from chronological age = 3.9 years Regression function: Age = a + b × CpG 1 + c × CpG 2 + d × CpG 3 + … Zbieć-Piekarska et al. Forensic Sci Int Genet (2015) Age Prediction in Saliva cg18384097 cg00481951 cg19671120 cg14361627 cg08928145cg12757011 cg07547549 Hong et al. Forensic Sci Int Genet (2017) 9
Age Prediction in Semen o Age correlation of the 3 CpGs and predicted versus chronological ages of 125 semen samples cg06304190 (TTC7B) cg12837463 cg06979108(NOX4) Rho = 0.882 MAD = 5.2 years cg06979108 cg06304190 cg12837463 Lee et al. Forensic Sci Int Genet (2015) Analysis of a Casework Example o A stain preliminary positive for semen and saliva o Two men’s mixed STR profile 10
Analysis of a Casework Example Semen age prediction (ppt) 60s cg06304190 cg12837463 cg06979108 Saliva age prediction (supernatant) Male 1 30s cg18384097 cg19671120 cg08928145 cg07547549 cg00481951 cg14361627 cg12757011 Male 2 Ethical and Legal Issues in FDP o FDP is prediction of appearance from forensic samples o FDP is developed to guide police investigations in cases without known suspects o FDP includes forensic use of DNA for investigation, not in the courtroom o Benefit and risk analysis will be needed o Law: Netherlands, Texas.. 11
Thank you for your attention! hylee192@yuhs.ac http://forensic.yonsei.ac.kr Picture from internet 12
Recommend
More recommend
Explore More Topics
Stay informed with curated content and fresh updates.