science for the public good improve human life

Science for the Public Good Improve Human Life Corn yield in - PowerPoint PPT Presentation

Science for the Public Good Improve Human Life Corn yield in Missouri Basic Scientific Research is Capital Not directed Curiosity driven Relies on prior work in many areas Basis for all applied research Vannevar Bush Government


  1. Science for the Public Good

  2. Improve Human Life Corn yield in Missouri

  3. “Basic Scientific Research is Capital” Not directed Curiosity driven Relies on prior work in many areas Basis for all applied research Vannevar Bush

  4. Government Policies Support Research billions

  5. Not possible to predict the utility of a specific research project It may take a long time before utility is discovered

  6. Global Positioning Satellites

  7. Strontium Lattice Clock Accurate – less than 1 second in 15 billion years Distance is determined by the time that light takes to arrive at object

  8. Velocity and Gravity distorts time-space

  9. Gravity distortion of time = 45 microseconds / day Velocity distortion of time = 7 microseconds / day Error of GPS system = 10 km /day

  10. Bacterial Genome of Streptococcus GTTTTAGAGCTGTGCTGTTTGAATGGTTCCAAAAC ttattacgttatggctctgctgttat GTTTTAGAGCTGTGCTGTTTGAATGGTTCCAAAA Lier, et al, Front. Genet., 15 June 2015

  11. Communicating Science • Support of scientific enterprise • Public understanding • Ability to use facts in decisions • Facts for Government Policies

  12. Policy Based on Science Climate Change Genetically Modified Foods Vaccines Energy Immigration Nuclear Arms Toxicology and pollution Emerging infectious diseases Etc., etc., etc.

  13. Facts vs Opinion

  14. Fact vs Fake

  15. Education

Recommend


More recommend


Explore More Topics

Stay informed with curated content and fresh updates.